RNAcoast:
- A tool for simultaneous prediction of RNA secondary structure and helix COAxial STacking.
- NOTE: All test results
are available under the resources
tab.
- Here is a sample output of RNAcoast. Line 1 shows the sequence
ID.
Lines 2 to 5 show the sequence and its secondary structure according to
RNAfold, Rfam, and RNAcoast (referred to as Prediction), respectively.
On line 6, the ^ symbols mark coaxial stacks of helices; they appear
right between the participating helices. Also on line 6, there is a
vertical line segment every 5 nucleotides. The rest is some info about
the number of basepairs (BP) in the mentioned secondary structures
(SS).
- tRNA56 >J01390.1/12505-12576
UAUGUUGUCGACUAAUCGGUAAGUCAUAAAUUUUUGGUAUUUAUAUUGGGUGUUCGAGUCGCCCCAACAUAA
(((((((..((((........))))......................(((((.......)))))))))))). [RNAfold]
(((((((..((((........)))).(((((.......)))))....(((((.......)))))))))))). [Rfam]
(((((((..((((........))))((((((.......))))))...(((((.......)))))))))))). [Prediction]
| |
| | |^
| | |
| | |
| ^ |
Predicted topology vs Rfam: similar
Prediction vs Rfam:
# of BPs in both secondary structures: 21
# of non-canonical BPs in the Rfam SS: 0
# of BPs only in the Rfam SS: 0
# of BPs only in the prediction SS: 1
Sequence length: 72
RNAfold vs Rfam:
# of BPs in both secondary structures: 16
# of non-canonical BPs in the Rfam SS: 0
# of BPs only in the Rfam SS: 5
# of BPs only in the RNAfold SS: 0
Sequence length: 72
RNAfold topology vs Rfam: DIFFERENT
- Here is a sample structure graph generated by RNAcoast for the
sequence >J01390.1/12505-12576 in the tRNA family.
- Each box represents a candidate region. The bottom rectangle is
the location of the region on the sequence. The top rectangle has two
integers, A-B. The integer A is the label of the region in the
input file resulted from the preprocessing step. B is the index of the
same region according to the Start Position Ordering (SPO).
- A directed
edge represents a backbone edge.
- A thick
solid edge represents a parallel coaxial stacking.
- A thick
dotted edge represents a 2-way junction with the weight only
shown on the left stacking.
- A thick
dashed edge represents a left or right nested coaxial stacking.
Contributers: